TantanApp

class biotite.application_v2.tantan.TantanApp(path: PathLike[str] | str = 'tantan')

Bases: LocalApp

A handle to tantan. [1]

Parameters:

pathstr, optional

Path of the tantan binary.

References

[1]

M. C. Frith, “A new repeat-masking method enables specific detection of homologous sequences,” Nucleic Acids Research, vol. 39, pp. e23-e23, March 2011. doi: 10.1093/nar/gkq1212

Examples

>>> sequence = NucleotideSequence("GGCATCGATATATATATATAGTCAA")
>>> masks = TantanApp().run([sequence]).result()
>>> repeat_mask = masks[0]
>>> print(repeat_mask)
[False False False False False False False False False  True  True  True
  True  True  True  True  True  True  True  True False False False False
 False]
>>> print(sequence, "\n" + "".join(["^" if e else " " for e in repeat_mask]))
GGCATCGATATATATATATAGTCAA
         ^^^^^^^^^^^

run(sequences: Iterable[NucleotideSequence | ProteinSequence], matrix: SubstitutionMatrix | None = None, **kwargs: Any) → CommandSetup[list[ndarray[tuple[K], dtype[bool]]]]

Mask sequence repeat regions.

Parameters:

sequencesiterable object of NucleotideSequence or ProteinSequence

The sequences to be masked. Masking multiple sequences in a single run decreases the run time compared to multiple runs with a single sequence. All sequences must be of the same type.

matrixSubstitutionMatrix, optional

The substitution matrix to use for repeat identification. A sequence segment is considered to be a repeat of another segment, if the substitution score between these segments is greater than a threshold value.

**kwargs

Additional command line options.

Returns:

futureFuture of list of ndarray, shape=(k,), dtype=bool

A handle to the running masking. Call Future.result() to obtain one boolean mask per input sequence (in input order), where each mask is true for the sequence positions identified as repeat.

References

Gallery

Finding homologous regions in two genomes

Finding homologous regions in two genomes