RNAfoldApp
#
- class biotite.application.viennarna.RNAfoldApp(sequence, temperature=37, bin_path='RNAfold')[source]#
Bases:
LocalApp
Compute the minimum free energy secondary structure of a ribonucleic acid sequence using ViennaRNA’s RNAfold software.
Internally this creates a
Popen
instance, which handles the execution.- Parameters:
- sequenceNucleotideSequence
The RNA sequence.
- temperatureint, optional
The temperature (°C) to be assumed for the energy parameters.
- bin_pathstr, optional
Path of the RNAfold binary.
Examples
>>> sequence = NucleotideSequence("CGACGTAGATGCTAGCTGACTCGATGC") >>> app = RNAfoldApp(sequence) >>> app.start() >>> app.join() >>> print(app.get_free_energy()) -1.3 >>> print(app.get_dot_bracket()) (((.((((.......)).)))))....
- add_additional_options(options)#
Add additional options for the command line program. These options are put before the arguments automatically determined by the respective
LocalApp
subclass.This method is focused on advanced users, who have knowledge on the available options of the command line program and the options already used by the
LocalApp
subclasses. Ignoring the already used options may result in conflicting CLI arguments and potential unexpected results. It is recommended to use this method only, when the respectiveLocalApp
subclass does not provide a method to set the desired option.- Parameters:
- optionslist of str
A list of strings representing the command line options.
Notes
In order to see which options the command line execution used, try the
get_command()
method.Examples
>>> seq1 = ProteinSequence("BIQTITE") >>> seq2 = ProteinSequence("TITANITE") >>> seq3 = ProteinSequence("BISMITE") >>> seq4 = ProteinSequence("IQLITE") >>> # Run application without additional arguments >>> app = ClustalOmegaApp([seq1, seq2, seq3, seq4]) >>> app.start() >>> app.join() >>> print(app.get_command()) clustalo --in ...fa --out ...fa --force --output-order=tree-order --seqtype Protein --guidetree-out ...tree >>> # Run application with additional argument >>> app = ClustalOmegaApp([seq1, seq2, seq3, seq4]) >>> app.add_additional_options(["--full"]) >>> app.start() >>> app.join() >>> print(app.get_command()) clustalo --full --in ...fa --out ...fa --force --output-order=tree-order --seqtype Protein --guidetree-out ...tree
- cancel()#
Cancel the application when in RUNNING or FINISHED state.
- clean_up()#
Do clean up work after the application terminates.
PROTECTED: Optionally override when inheriting.
- static compute_secondary_structure(sequence, bin_path='RNAfold')#
Compute the minimum free energy secondary structure of a ribonucleic acid sequence using ViennaRNA’s RNAfold software.
This is a convenience function, that wraps the
RNAfoldApp
execution.- Parameters:
- sequenceNucleotideSequence
The RNA sequence.
- bin_pathstr, optional
Path of the RNAfold binary.
- Returns:
- dotbracketstr
The secondary structure in dot bracket notation.
- free_energyfloat
The free energy.
- get_app_state()#
Get the current app state.
- Returns:
- app_stateAppState
The current app state.
- get_base_pairs()#
Get the base pairs from the minimum free energy secondary structure of the input sequence.
- Returns:
- base_pairsndarray, shape=(n,2)
Each row corresponds to the positions of the bases in the sequence.
Examples
>>> sequence = NucleotideSequence("CGACGTAGATGCTAGCTGACTCGATGC") >>> app = RNAfoldApp(sequence) >>> app.start() >>> app.join() >>> print(app.get_base_pairs()) [[ 0 22] [ 1 21] [ 2 20] [ 4 19] [ 5 18] [ 6 16] [ 7 15]]
For reference, the corresponding dot bracket notation can be displayed as below.
>>> print(app.get_dot_bracket()) (((.((((.......)).)))))....
- get_command()#
Get the executed command.
Cannot be called until the application has been started.
- Returns:
- commandstr
The executed command.
Examples
>>> seq1 = ProteinSequence("BIQTITE") >>> seq2 = ProteinSequence("TITANITE") >>> seq3 = ProteinSequence("BISMITE") >>> seq4 = ProteinSequence("IQLITE") >>> app = ClustalOmegaApp([seq1, seq2, seq3, seq4]) >>> app.start() >>> print(app.get_command()) clustalo --in ...fa --out ...fa --force --output-order=tree-order --seqtype Protein --guidetree-out ...tree
- get_dot_bracket()#
Get the minimum free energy secondary structure of the input sequence in dot bracket notation.
- Returns:
- dotbracketstr
The secondary structure in dot bracket notation.
Examples
>>> sequence = NucleotideSequence("CGACGTAGATGCTAGCTGACTCGATGC") >>> app = RNAfoldApp(sequence) >>> app.start() >>> app.join() >>> print(app.get_dot_bracket()) (((.((((.......)).)))))....
- get_exit_code()#
Get the exit code of the process.
PROTECTED: Do not call from outside.
- Returns:
- codeint
The exit code.
- get_free_energy()#
Get the free energy (kcal/mol) of the suggested secondary structure.
- Returns:
- free_energyfloat
The free energy.
Examples
>>> sequence = NucleotideSequence("CGACGTAGATGCTAGCTGACTCGATGC") >>> app = RNAfoldApp(sequence) >>> app.start() >>> app.join() >>> print(app.get_free_energy()) -1.3
- get_process()#
Get the Popen instance.
PROTECTED: Do not call from outside.
- Returns:
- processPopen
The Popen instance.
- get_stderr()#
Get the STDERR pipe content of the process.
PROTECTED: Do not call from outside.
- Returns:
- stdoutstr
The standard error.
- get_stdout()#
Get the STDOUT pipe content of the process.
PROTECTED: Do not call from outside.
- Returns:
- stdoutstr
The standard output.
- is_finished()#
Check if the application has finished.
PROTECTED: Override when inheriting.
- Returns:
- finishedbool
True of the application has finished, false otherwise.
- join(timeout=None)#
Conclude the application run and set its state to JOINED. This can only be done from the RUNNING or FINISHED state.
If the application is FINISHED the joining process happens immediately, if otherwise the application is RUNNING, this method waits until the application is FINISHED.
- Parameters:
- timeoutfloat, optional
If this parameter is specified, the
Application
only waits for finishing until this value (in seconds) runs out. After this time is exceeded aTimeoutError
is raised and the application is cancelled.
- Raises:
- TimeoutError
If the joining process exceeds the timeout value.
- set_arguments(arguments)#
Set command line arguments for the application run.
PROTECTED: Do not call from outside.
- Parameters:
- argumentslist of str
A list of strings representing the command line options.
- set_constraints(pairs=None, paired=None, unpaired=None, downstream=None, upstream=None, enforce=False)#
Add constraints of known paired or unpaired bases to the folding algorithm.
Constraints forbid pairs conflicting with the respective constraint.
- Parameters:
- pairsndarray, shape=(n,2), dtype=int, optional
Positions of constrained base pairs.
- pairedndarray, shape=(n,), dtype=int or dtype=bool, optional
Positions of bases that are paired with any other base.
- unpairedndarray, shape=(n,), dtype=int or dtype=bool, optional
Positions of bases that are unpaired.
- downstreamndarray, shape=(n,), dtype=int or dtype=bool, optional
Positions of bases that are paired with any downstream base.
- upstreamndarray, shape=(n,), dtype=int or dtype=bool, optional
Positions of bases that are paired with any upstream base.
- enforcebool, optional
If set to true, the given constraints are enforced, i.e. a the respective base pairs must form. By default (false), a constraint does only forbid formation of a pair that would conflict with this constraint.
- set_exec_dir(exec_dir)#
Set the directory where the application should be executed. If not set, it will be executed in the working directory at the time the application was created.
PROTECTED: Do not call from outside.
- Parameters:
- exec_dirstr
The execution directory.
- set_stdin(file)#
Set a file as standard input for the application run.
PROTECTED: Do not call from outside.
- Parameters:
- filefile object
The file for the standard input. Must have a valid file descriptor, e.g. file-like objects such as StringIO are invalid.
- set_temperature(temperature)#
Adjust the energy parameters according to a temperature in degrees Celsius.
- Parameters:
- temperatureint
The temperature.
- start()#
Start the application run and set its state to RUNNING. This can only be done from the CREATED state.
- wait_interval()#
The time interval of
is_finished()
calls in the joining process.PROTECTED: Override when inheriting.
- Returns:
- intervalfloat
Time (in seconds) between calls of
is_finished()
injoin()
.