TantanApp#
- class biotite.application.tantan.TantanApp(sequence: NucleotideSequence | ProteinSequence | Sequence[NucleotideSequence | ProteinSequence], matrix: SubstitutionMatrix | None = None, bin_path: PathLike[str] | str = 'tantan')[source]#
Bases:
LocalAppMask sequence repeat regions using tantan. [1]
- Parameters:
- sequence(list of) NucleotideSequence or ProteinSequence
The sequence(s) to be masked. Either a single sequence or multiple sequences can be masked. Masking multiple sequences in a single run decreases the run time compared to multiple runs with a single sequence. All sequences must be of the same type.
- matrixSubstitutionMatrix, optional
The substitution matrix to use for repeat identification. A sequence segment is considered to be a repeat of another segment, if the substitution score between these segments is greater than a threshold value.
- bin_pathstr, optional
Path of the tantan binary.
References
Examples
>>> sequence = NucleotideSequence("GGCATCGATATATATATATAGTCAA") >>> app = TantanApp(sequence) >>> app.start() >>> app.join() >>> repeat_mask = app.get_mask() >>> print(repeat_mask) [False False False False False False False False False True True True True True True True True True True True False False False False False] >>> print(sequence, "\n" + "".join(["^" if e else " " for e in repeat_mask])) GGCATCGATATATATATATAGTCAA ^^^^^^^^^^^
- add_additional_options(options: Sequence[str]) None#
Add additional options for the command line program. These options are put before the arguments automatically determined by the respective
LocalAppsubclass.This method is focused on advanced users, who have knowledge on the available options of the command line program and the options already used by the
LocalAppsubclasses. Ignoring the already used options may result in conflicting CLI arguments and potential unexpected results. It is recommended to use this method only, when the respectiveLocalAppsubclass does not provide a method to set the desired option.- Parameters:
- optionslist of str
A list of strings representing the command line options.
Notes
In order to see which options the command line execution used, try the
get_command()method.Examples
>>> seq1 = ProteinSequence("BIQTITE") >>> seq2 = ProteinSequence("TITANITE") >>> seq3 = ProteinSequence("BISMITE") >>> seq4 = ProteinSequence("IQLITE") >>> # Run application without additional arguments >>> app = ClustalOmegaApp([seq1, seq2, seq3, seq4]) >>> app.start() >>> app.join() >>> print(app.get_command()) clustalo --in ...fa --out ...fa --force --output-order=tree-order --seqtype Protein --guidetree-out ...tree >>> # Run application with additional argument >>> app = ClustalOmegaApp([seq1, seq2, seq3, seq4]) >>> app.add_additional_options(["--full"]) >>> app.start() >>> app.join() >>> print(app.get_command()) clustalo --full --in ...fa --out ...fa --force --output-order=tree-order --seqtype Protein --guidetree-out ...tree
- cancel() None#
Cancel the application when in RUNNING or FINISHED state.
- clean_up() None#
Do clean up work after the application terminates.
PROTECTED: Optionally override when inheriting.
- evaluate() None#
Evaluate application results. Called in
join().PROTECTED: Override when inheriting.
- get_app_state() AppState#
Get the current app state.
- Returns:
- app_stateAppState
The current app state.
- get_command() str#
Get the executed command.
Cannot be called until the application has been started.
- Returns:
- commandstr
The executed command.
Examples
>>> seq1 = ProteinSequence("BIQTITE") >>> seq2 = ProteinSequence("TITANITE") >>> seq3 = ProteinSequence("BISMITE") >>> seq4 = ProteinSequence("IQLITE") >>> app = ClustalOmegaApp([seq1, seq2, seq3, seq4]) >>> app.start() >>> print(app.get_command()) clustalo --in ...fa --out ...fa --force --output-order=tree-order --seqtype Protein --guidetree-out ...tree
- get_exit_code() int#
Get the exit code of the process.
PROTECTED: Do not call from outside.
- Returns:
- codeint
The exit code.
- get_mask() ndarray[tuple[N], dtype[bool]] | list[ndarray[tuple[N], dtype[bool]]]#
Get a boolean mask covering identified repeat regions of each input sequence.
- Returns:
- repeat_mask(list of) ndarray, shape=(n,), dtype=bool
A boolean mask that is true for each sequence position that is identified as repeat. If a list of sequences were given as input, a list of masks is returned instead.
- get_process() Popen[str]#
Get the Popen instance.
PROTECTED: Do not call from outside.
- Returns:
- processPopen
The Popen instance.
- get_stderr() str#
Get the STDERR pipe content of the process.
PROTECTED: Do not call from outside.
- Returns:
- stdoutstr
The standard error.
- get_stdout() str#
Get the STDOUT pipe content of the process.
PROTECTED: Do not call from outside.
- Returns:
- stdoutstr
The standard output.
- is_finished() bool#
Check if the application has finished.
PROTECTED: Override when inheriting.
- Returns:
- finishedbool
True of the application has finished, false otherwise.
- join(timeout: float | None = None) None#
Conclude the application run and set its state to JOINED. This can only be done from the RUNNING or FINISHED state.
If the application is FINISHED the joining process happens immediately, if otherwise the application is RUNNING, this method waits until the application is FINISHED.
- Parameters:
- timeoutfloat, optional
If this parameter is specified, the
Applicationonly waits for finishing until this value (in seconds) runs out. After this time is exceeded aTimeoutErroris raised and the application is cancelled.
- Raises:
- TimeoutError
If the joining process exceeds the timeout value.
- static mask_repeats(sequence: NucleotideSequence | ProteinSequence | Sequence[NucleotideSequence | ProteinSequence], matrix: SubstitutionMatrix | None = None, bin_path: PathLike[str] | str = 'tantan') ndarray[tuple[N], dtype[bool]] | list[ndarray[tuple[N], dtype[bool]]]#
Mask repeat regions of the given input sequence(s).
- Parameters:
- sequence(list of) NucleotideSequence or ProteinSequence
The sequence(s) to be masked. Either a single sequence or multiple sequences can be masked. Masking multiple sequences in a single run decreases the run time compared to multiple runs with a single sequence. All sequences must be of the same type.
- matrixSubstitutionMatrix, optional
The substitution matrix to use for repeat identification. A sequence segment is considered to be a repeat of another segment, if the substitution score between these segments is greater than a threshold value.
- bin_pathstr, optional
Path of the tantan binary.
- Returns:
- repeat_mask(list of) ndarray, shape=(n,), dtype=bool
A boolean mask that is true for each sequence position that is identified as repeat. If a list of sequences were given as input, a list of masks is returned instead.
- set_arguments(arguments: Sequence[str]) None#
Set command line arguments for the application run.
PROTECTED: Do not call from outside.
- Parameters:
- argumentslist of str
A list of strings representing the command line options.
- set_exec_dir(exec_dir: PathLike[str] | str) None#
Set the directory where the application should be executed. If not set, it will be executed in the working directory at the time the application was created.
PROTECTED: Do not call from outside.
- Parameters:
- exec_dirstr
The execution directory.
- set_stdin(file: IO[Any]) None#
Set a file as standard input for the application run.
PROTECTED: Do not call from outside.
- Parameters:
- filefile object
The file for the standard input. Must have a valid file descriptor, e.g. file-like objects such as StringIO are invalid.
- start() None#
Start the application run and set its state to RUNNING. This can only be done from the CREATED state.
- wait_interval() float#
The time interval of
is_finished()calls in the joining process.PROTECTED: Override when inheriting.
- Returns:
- intervalfloat
Time (in seconds) between calls of
is_finished()injoin().